ID: 900379523_900379531

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 900379523 900379531
Species Human (GRCh38) Human (GRCh38)
Location 1:2377016-2377038 1:2377041-2377063
Sequence CCCAGGCACAGTCCAGGCCGATG CAGCGTGGAGAGTTACGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 167} {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!