ID: 900379527_900379535

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 900379527 900379535
Species Human (GRCh38) Human (GRCh38)
Location 1:2377033-2377055 1:2377064-2377086
Sequence CCGATGCCCAGCGTGGAGAGTTA GCCTCAGCCACACACAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60} {0: 1, 1: 0, 2: 3, 3: 68, 4: 914}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!