ID: 900382281_900382285

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900382281 900382285
Species Human (GRCh38) Human (GRCh38)
Location 1:2391004-2391026 1:2391054-2391076
Sequence CCAAAGTGCTGGAAGTACAGGCA GTTTCTGGACAGCACCGGCCAGG
Strand - +
Off-target summary {0: 16, 1: 4736, 2: 103594, 3: 240794, 4: 248281} {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!