ID: 900386213_900386224

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900386213 900386224
Species Human (GRCh38) Human (GRCh38)
Location 1:2412233-2412255 1:2412268-2412290
Sequence CCCTGAATGGCCGCAGGGCAGGC CGGGTCCCAGGTTGTGGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127} {0: 1, 1: 0, 2: 1, 3: 13, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!