ID: 900386214_900386224

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 900386214 900386224
Species Human (GRCh38) Human (GRCh38)
Location 1:2412234-2412256 1:2412268-2412290
Sequence CCTGAATGGCCGCAGGGCAGGCG CGGGTCCCAGGTTGTGGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89} {0: 1, 1: 0, 2: 1, 3: 13, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!