ID: 900388673_900388687

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 900388673 900388687
Species Human (GRCh38) Human (GRCh38)
Location 1:2423524-2423546 1:2423559-2423581
Sequence CCTCAAATCCACCTCCCCTGGAG GTTCTTAAGGAGATTATGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 50, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!