ID: 900390981_900391001

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900390981 900391001
Species Human (GRCh38) Human (GRCh38)
Location 1:2433815-2433837 1:2433865-2433887
Sequence CCCTGCCGGCTCCCCAAACCCCC GTGCCCACACTGGGGGTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 511} {0: 1, 1: 0, 2: 3, 3: 28, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!