ID: 900390989_900391004

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900390989 900391004
Species Human (GRCh38) Human (GRCh38)
Location 1:2433835-2433857 1:2433874-2433896
Sequence CCCTCAGAGCCATCGACTCCCTC CTGGGGGTCCCGGGTGATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 136} {0: 1, 1: 0, 2: 0, 3: 14, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!