ID: 900394085_900394099

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 900394085 900394099
Species Human (GRCh38) Human (GRCh38)
Location 1:2446070-2446092 1:2446114-2446136
Sequence CCTCCCGCTGCCTGGCCGGGCTT GTCCACTGCAGTCCTAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 213} {0: 1, 1: 0, 2: 2, 3: 14, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!