ID: 900406147_900406151

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900406147 900406151
Species Human (GRCh38) Human (GRCh38)
Location 1:2493903-2493925 1:2493921-2493943
Sequence CCAGGGGTGTGGGAGGGTGTGTG GTGTGTGCAGGGGCGTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 160, 4: 1151} {0: 1, 1: 0, 2: 3, 3: 51, 4: 461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!