ID: 900412668_900412681

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 900412668 900412681
Species Human (GRCh38) Human (GRCh38)
Location 1:2520014-2520036 1:2520042-2520064
Sequence CCAGAAACCAAGCCCATGGCAGG CGCGCGGGCAGGGGGTAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 245} {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!