ID: 900438455_900438464

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 900438455 900438464
Species Human (GRCh38) Human (GRCh38)
Location 1:2642182-2642204 1:2642215-2642237
Sequence CCCACTGCTCTTCTCCCTGGGCC GACCTGGATTTACCTCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 607} {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!