ID: 900439369_900439377

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 900439369 900439377
Species Human (GRCh38) Human (GRCh38)
Location 1:2645705-2645727 1:2645739-2645761
Sequence CCTGCCCCTTCCTGCTTCTCTGT CCTACCATCCCTCCTGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 131, 4: 1049} {0: 1, 1: 0, 2: 2, 3: 9, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!