|
Left Crispr |
Right Crispr |
Crispr ID |
900447653 |
900447660 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:2689434-2689456
|
1:2689480-2689502
|
Sequence |
CCGCATGGAATGGCATCCTCACC |
GGAGCAGCGCCCACACCCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 14, 1: 12, 2: 9, 3: 12, 4: 128} |
{0: 40, 1: 181, 2: 365, 3: 431, 4: 509} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|