ID: 900458559_900458563

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 900458559 900458563
Species Human (GRCh38) Human (GRCh38)
Location 1:2789394-2789416 1:2789407-2789429
Sequence CCACTGCCTCCGTTCATTCCTTT TCATTCCTTTGTAAAATAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 684} {0: 1, 1: 0, 2: 1, 3: 28, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!