ID: 900484900_900484901

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900484900 900484901
Species Human (GRCh38) Human (GRCh38)
Location 1:2917857-2917879 1:2917871-2917893
Sequence CCAGCTTCTGCAGGCTCTGGCTT CTCTGGCTTTCCTTGACTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 366} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!