ID: 900485753_900485757

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 900485753 900485757
Species Human (GRCh38) Human (GRCh38)
Location 1:2921902-2921924 1:2921915-2921937
Sequence CCTCTGTCCATCTGTCCATCCAG GTCCATCCAGCTCTGCAGGAGGG
Strand - +
Off-target summary No data {0: 12, 1: 3, 2: 2, 3: 16, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!