ID: 900502884_900502900

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 900502884 900502900
Species Human (GRCh38) Human (GRCh38)
Location 1:3015272-3015294 1:3015318-3015340
Sequence CCTGCAGCCTGGTCCTCCCACCA GGCAGAGGTGCCTGGTAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 460} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!