ID: 900502885_900502903

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900502885 900502903
Species Human (GRCh38) Human (GRCh38)
Location 1:3015279-3015301 1:3015329-3015351
Sequence CCTGGTCCTCCCACCACCCTCCT CTGGTAGCTTGGCAGTGTCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!