ID: 900516919_900516936

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 900516919 900516936
Species Human (GRCh38) Human (GRCh38)
Location 1:3086537-3086559 1:3086590-3086612
Sequence CCTCCTCCCGCCGGGCTGCCTTG AGCACAAGGGCTGGGAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 1672} {0: 1, 1: 2, 2: 2, 3: 54, 4: 780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!