ID: 900522575_900522590

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900522575 900522590
Species Human (GRCh38) Human (GRCh38)
Location 1:3112846-3112868 1:3112887-3112909
Sequence CCGCCTGGGCTCCAGCCCCATCA TCCCGGGCCATCCTTCTTGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 570} {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!