ID: 900523365_900523378

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 900523365 900523378
Species Human (GRCh38) Human (GRCh38)
Location 1:3116750-3116772 1:3116792-3116814
Sequence CCTGAAGCCCTCACCCCAGCAGG TGGCCCCGCTGGTGACTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 389} {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!