ID: 900538768_900538772

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 900538768 900538772
Species Human (GRCh38) Human (GRCh38)
Location 1:3192369-3192391 1:3192384-3192406
Sequence CCAGGCTCTGGATTAATGACCAG ATGACCAGGCTCAGGGTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96} {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!