ID: 900544019_900544026

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 900544019 900544026
Species Human (GRCh38) Human (GRCh38)
Location 1:3218472-3218494 1:3218514-3218536
Sequence CCACTCCAAGGCACACATACGCA CCGCCCGCACAGGTGGGCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 233} {0: 1, 1: 0, 2: 1, 3: 5, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!