ID: 900544666_900544681

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 900544666 900544681
Species Human (GRCh38) Human (GRCh38)
Location 1:3222036-3222058 1:3222080-3222102
Sequence CCAGCAGAGGTCTGCAGGCCCCG GGGAGGCCCAAGGGGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 224} {0: 1, 1: 0, 2: 11, 3: 235, 4: 1932}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!