ID: 900549635_900549646

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 900549635 900549646
Species Human (GRCh38) Human (GRCh38)
Location 1:3247784-3247806 1:3247832-3247854
Sequence CCGGCGCTTCCCAAAAAGTCACA GCCTTTCCTGGCCGCGGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 114} {0: 1, 1: 0, 2: 2, 3: 13, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!