ID: 900555400_900555403

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 900555400 900555403
Species Human (GRCh38) Human (GRCh38)
Location 1:3277899-3277921 1:3277938-3277960
Sequence CCCATACACTCATGCACATGAGC CACCGTGAAGTCCGTGCATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141} {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!