ID: 900558510_900558522

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 900558510 900558522
Species Human (GRCh38) Human (GRCh38)
Location 1:3291936-3291958 1:3291967-3291989
Sequence CCCACACAGCAGGTGCCTTCTCC TTTGGGGCCTACCCGGTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 232} {0: 1, 1: 0, 2: 1, 3: 19, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!