ID: 900562815_900562828

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 900562815 900562828
Species Human (GRCh38) Human (GRCh38)
Location 1:3316092-3316114 1:3316135-3316157
Sequence CCTGTTCCTTTTTAAACGTTTCA GACTGAGGGCGGGTGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 297} {0: 1, 1: 0, 2: 7, 3: 113, 4: 2078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!