ID: 900606926_900606937

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 900606926 900606937
Species Human (GRCh38) Human (GRCh38)
Location 1:3527882-3527904 1:3527929-3527951
Sequence CCACCTCTCTCAGCCACTAGTCC GAAAATGCACAGGCCCAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 303} {0: 1, 1: 0, 2: 3, 3: 20, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!