ID: 900610989_900611002

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 900610989 900611002
Species Human (GRCh38) Human (GRCh38)
Location 1:3544586-3544608 1:3544636-3544658
Sequence CCTGGGGAGTGCTCCACACACCG GGCAGCCCCCAGCAGGGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107} {0: 1, 1: 2, 2: 2, 3: 52, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!