ID: 900611606_900611615

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 900611606 900611615
Species Human (GRCh38) Human (GRCh38)
Location 1:3546762-3546784 1:3546783-3546805
Sequence CCACCATGGCGGGGTGGCAATGG GGCCTGGGAAGGGGGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 87} {0: 1, 1: 4, 2: 13, 3: 95, 4: 850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!