ID: 900613306_900613317

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 900613306 900613317
Species Human (GRCh38) Human (GRCh38)
Location 1:3553456-3553478 1:3553497-3553519
Sequence CCTCACCATGCAGGATAGAGGCT CCTCCCCACACCCCAGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163} {0: 1, 1: 0, 2: 15, 3: 122, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!