ID: 900613308_900613317

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 900613308 900613317
Species Human (GRCh38) Human (GRCh38)
Location 1:3553461-3553483 1:3553497-3553519
Sequence CCATGCAGGATAGAGGCTGGAGC CCTCCCCACACCCCAGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 242} {0: 1, 1: 0, 2: 15, 3: 122, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!