ID: 900613318_900613324

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 900613318 900613324
Species Human (GRCh38) Human (GRCh38)
Location 1:3553500-3553522 1:3553515-3553537
Sequence CCCCACACCCCAGGCAGGGGAGC AGGGGAGCTGTCCTCAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 875} {0: 1, 1: 0, 2: 3, 3: 42, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!