ID: 900613319_900613324

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900613319 900613324
Species Human (GRCh38) Human (GRCh38)
Location 1:3553501-3553523 1:3553515-3553537
Sequence CCCACACCCCAGGCAGGGGAGCT AGGGGAGCTGTCCTCAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 357} {0: 1, 1: 0, 2: 3, 3: 42, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!