ID: 900615400_900615410

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 900615400 900615410
Species Human (GRCh38) Human (GRCh38)
Location 1:3563408-3563430 1:3563437-3563459
Sequence CCAGCTATAGGTCCGTCCCCTCG CTGGAGTCACAGCTGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21} {0: 1, 1: 0, 2: 3, 3: 49, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!