ID: 900617929_900617939

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 900617929 900617939
Species Human (GRCh38) Human (GRCh38)
Location 1:3573662-3573684 1:3573690-3573712
Sequence CCAGAGCCCGCCCTTCCAGGAGC CCTCCCCTCCCACCACTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 263} {0: 1, 1: 0, 2: 13, 3: 163, 4: 1142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!