ID: 900617929_900617940

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 900617929 900617940
Species Human (GRCh38) Human (GRCh38)
Location 1:3573662-3573684 1:3573691-3573713
Sequence CCAGAGCCCGCCCTTCCAGGAGC CTCCCCTCCCACCACTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 263} {0: 1, 1: 0, 2: 7, 3: 74, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!