ID: 900625543_900625551

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 900625543 900625551
Species Human (GRCh38) Human (GRCh38)
Location 1:3606965-3606987 1:3607013-3607035
Sequence CCTGGGGCCTGCTGTGCAGCCTG CAATTCAGCATCTGGAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 549} {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!