ID: 900626582_900626595

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 900626582 900626595
Species Human (GRCh38) Human (GRCh38)
Location 1:3611348-3611370 1:3611399-3611421
Sequence CCATAGGACGCAGCCACAGGTGC GCTGCAGGTGCGGAGCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 124} {0: 1, 1: 1, 2: 6, 3: 22, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!