ID: 900647268_900647272

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 900647268 900647272
Species Human (GRCh38) Human (GRCh38)
Location 1:3714604-3714626 1:3714618-3714640
Sequence CCAGAGGCCGGAGGAGAGGCCAG AGAGGCCAGGCTACTGGCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 421} {0: 1, 1: 0, 2: 1, 3: 19, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!