ID: 900649214_900649218

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 900649214 900649218
Species Human (GRCh38) Human (GRCh38)
Location 1:3722817-3722839 1:3722834-3722856
Sequence CCTGGCATGGGGCCGGGCACCTC CACCTCTCTGCACCTGGCATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 56, 3: 3192, 4: 18562} {0: 2, 1: 4, 2: 5, 3: 29, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!