ID: 900649312_900649318

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 900649312 900649318
Species Human (GRCh38) Human (GRCh38)
Location 1:3723228-3723250 1:3723255-3723277
Sequence CCTCTCTGCACCTGACATGGGGC CACCCTTTGAACCCGGCACAGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 6, 3: 27, 4: 222} {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!