ID: 900655305_900655311

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 900655305 900655311
Species Human (GRCh38) Human (GRCh38)
Location 1:3753956-3753978 1:3753996-3754018
Sequence CCACACGGTGTCCTGGGTGTGGG ACTCATAGGCACCTGCCATTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 203} {0: 1, 1: 1, 2: 0, 3: 2, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!