ID: 900660875_900660883

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 900660875 900660883
Species Human (GRCh38) Human (GRCh38)
Location 1:3782787-3782809 1:3782836-3782858
Sequence CCAGGCATAATTATAAAAGAAAC CTGTGGTCCCAGCACTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 324} {0: 3, 1: 38, 2: 160, 3: 937, 4: 6697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!