ID: 900663032_900663040

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 900663032 900663040
Species Human (GRCh38) Human (GRCh38)
Location 1:3795642-3795664 1:3795661-3795683
Sequence CCTAGTATGTTGGTGTGGCCAGG CAGGAGAAGGGGGAGTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161} {0: 2, 1: 0, 2: 4, 3: 113, 4: 1043}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!