ID: 900673398_900673405

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 900673398 900673405
Species Human (GRCh38) Human (GRCh38)
Location 1:3869617-3869639 1:3869644-3869666
Sequence CCCTCCACGGTGGGTGCGGAGGC GAGGAATTCCTGCGGGTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 175} {0: 1, 1: 0, 2: 2, 3: 12, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!