ID: 900676537_900676540

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 900676537 900676540
Species Human (GRCh38) Human (GRCh38)
Location 1:3890689-3890711 1:3890707-3890729
Sequence CCCTGGCTCATTCTGCTTCTGCA CTGCACAGTGGAGCTGCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 394} {0: 1, 1: 0, 2: 0, 3: 33, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!