ID: 900676537_900676541

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 900676537 900676541
Species Human (GRCh38) Human (GRCh38)
Location 1:3890689-3890711 1:3890722-3890744
Sequence CCCTGGCTCATTCTGCTTCTGCA GCTGTTGGATTCTTCTGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 394} {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!